Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756414

Morpholino Name: gna11 MO2
Synonyms:
mRNA Target: gna11

Morpholino Type: uncategorized morpholino
Sequence:
5' TTGAATCTAGAGTCATCCCTTCCCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GGGGAAGGGATGACTCTGGATTCAA 3' ||||||||||||||||| ||||||| 3' CCCCTTCCCTACTGAGATCTAAGTT 5' 5' GGGGAAGGGATGACTCTAGATTCAA 3' ||||||||||||||||||||||||| 3' CCCCTTCCCTACTGAGATCTAAGTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold4363:838263..838287 25/25 Antisense target gna11
Scaffold70461:877904..877928 25/25 Antisense off-target Xelaev16069535m
Scaffold16004:1377321..1377345 21/25 unknown
Scaffold73623:1293656..1293680 21/25 unknown
tropicalis 7.1 scaffold_1:128662386..128662410 24/25 Antisense target gna11
Publications
First: Polycystin 1 loss of function is directly linked to an imbalance in G-protein signaling in the kidney., Development 2018                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556