Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756450

Morpholino Name: mapk6 MO1
Synonyms: ERK3 MO1
mRNA Target: mapk6

Morpholino Type: uncategorized morpholino
Sequence:
5' AAACTTTTCTGCCATTTTGGTGACC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGTCACCAAAATGGCAGAAAAGTTT 3' ||||||||||||||||||||||||| 3' CCAGTGGTTTTACCGTCTTTTCAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold9266:807567..807591 25/25 Antisense off-target Xelaev16078612m
Scaffold18184:2333038..2333062 22/25 unknown
Scaffold12020:2375569..2375593 21/25 unknown
Scaffold167347:1603176..1603200 21/25 unknown
Scaffold25212:1015046..1015070 21/25 unknown
Scaffold30987:4887908..4887932 21/25 unknown
Scaffold40421:386444..386468 21/25 unknown
Scaffold7000:196522..196546 21/25 unknown
Scaffold94216:2061..2085 21/25 unknown
tropicalis 7.1 scaffold_3:34102205..34102229 25/25 Antisense target mapk6
scaffold_1:214190019..214190043 21/25 unknown
scaffold_3:99970754..99970778 21/25 Antisense off-target plxnb2
scaffold_4:56128633..56128657 21/25 Antisense off-target unnamed
scaffold_5:46501334..46501358 21/25 Antisense off-target ascc3
scaffold_9:13843379..13843403 21/25 Sense off-target gcg
Publications
First: The atypical mitogen-activated protein kinase ERK3 is essential for establishment of epithelial architecture., J Biol Chem 2018                                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556