Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756450

Morpholino Name: mapk6 MO1
Synonyms: ERK3 MO1
Target mRNA: mapk6

Morpholino Type: uncategorized morpholino
Sequence: 5' AAACTTTTCTGCCATTTTGGTGACC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GGTCACCAAAATGGCAGAAAAGTTT 3' ||||||||||||||||||||||||| 3' CCAGTGGTTTTACCGTCTTTTCAAA 5' 5' GGTCACCAAAATGGCAGAAAAGTTT 3' ||||||||||||||||||||||||| 3' CCAGTGGTTTTACCGTCTTTTCAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:92216404..92216428 25/25 Antisense target mapk6.L
chr5L:34806885..34806909 21/25 Sense off-target kiz.L
chr3L:44715783..44715807 22/25 unknown
Scaffold21:5281528..5281552 21/25 unknown
chr3L:144104408..144104432 21/25 unknown
chr3S:102487596..102487620 21/25 unknown
chr5L:100686215..100686239 21/25 unknown
chr8L:32066201..32066225 21/25 unknown
chr9_10L:20830734..20830758 21/25 unknown
tropicalis 10.0 Chr3:102185250..102185274 25/25 Antisense target mapk6
Chr4:29981398..29981422 21/25 Antisense off-target Xetrov107028953m.g
Chr4:29981398..29981422 21/25 Antisense off-target LOC100494113
Chr5:81520622..81520646 21/25 Antisense off-target ascc3
Chr9:72015726..72015750 21/25 Sense off-target gcg
Chr3:71483734..71483758 21/25 Antisense off-target plxnb2
Chr4:113444821..113444845 21/25 unknown
Chr1:3676338..3676362 21/25 unknown
Chr3:149806806..149806830 21/25 unknown
Publications
First: The atypical mitogen-activated protein kinase ERK3 is essential for establishment of epithelial architecture., J Biol Chem 2018                                        
Most recent:
View All Papers