Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756451

Morpholino Name: mapk6 MO2
Synonyms: ERK3 MO2
mRNA Target: mapk6

Morpholino Type: uncategorized morpholino
Sequence:
5' CATGGTGACGACTTTTCTTCCGCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold268638:1110764..1110788 25/25 Antisense off-target Xelaev16036336m
Publications
First: The atypical mitogen-activated protein kinase ERK3 is essential for establishment of epithelial architecture., J Biol Chem 2018                                        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556