Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756451

Morpholino Name: mapk6 MO2
Synonyms: ERK3 MO2
Target mRNA: mapk6

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGTGACGACTTTTCTTCCGCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAGCGGAAGAAAAGTCGTCACCATG 3' ||||||||||||||||||||||||| 3' CTCGCCTTCTTTTCAGCAGTGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:50795953..50795977 25/25 Antisense target mapk6.S
Publications
First: The atypical mitogen-activated protein kinase ERK3 is essential for establishment of epithelial architecture., J Biol Chem 2018                                        
Most recent:
View All Papers