Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756452

Morpholino Name: mapk6 MO3
Synonyms:
mRNA Target: mapk6

Morpholino Type: uncategorized morpholino
Sequence:
5' TGAGGCTTTCAAACTTTTCTGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' TGGCAGAAAAGTTTGAAAGCCTCA 3' |||||||||||||||||||||||| 3' ACCGTCTTTTCAAACTTTCGGAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold268638:1110787..1110810 24/24 Antisense off-target Xelaev16036336m
Scaffold9266:807557..807580 24/24 Antisense off-target Xelaev16078612m
Scaffold52441:4231558..4231581 21/24 unknown
Scaffold8630:1255135..1255158 21/24 unknown
Scaffold38656:2375202..2375225 20/24 Antisense off-target Xelaev16049460m
Scaffold52573:5976454..5976477 20/24 unknown
Scaffold58878:4225508..4225531 20/24 Sense off-target dctn6
Scaffold80885:375669..375692 20/24 unknown
tropicalis 7.1 scaffold_3:34102216..34102239 24/24 Antisense target mapk6
scaffold_1:156977168..156977191 21/24 unknown
scaffold_2:20160897..20160920 20/24 unknown
scaffold_9:24493712..24493735 20/24 unknown
Publications
First: The atypical mitogen-activated protein kinase ERK3 is essential for establishment of epithelial architecture., J Biol Chem 2018                                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556