Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756452

Morpholino Name: mapk6 MO3
Synonyms:
Target mRNA: mapk6

Morpholino Type: uncategorized morpholino
Sequence: 5' TGAGGCTTTCAAACTTTTCTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGCAGAAAAGTTTGAAAGCCTCA 3' ||||||||||||||||||||||||| 3' TACCGTCTTTTCAAACTTTCGGAGT 5' 5' ATGGCAGAAAAGTTTGAAAGCCTCA 3' ||||||||||||||||||||||||| 3' TACCGTCTTTTCAAACTTTCGGAGT 5' 5' ATGGCAGAAAAGTTTGAAAGCCTCA 3' ||||||||||||||||||||||||| 3' TACCGTCTTTTCAAACTTTCGGAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:92216394..92216418 25/25 Antisense target mapk6.L
chr3S:50795975..50795999 25/25 Antisense target mapk6.S
Scaffold28:1414940..1414964 21/25 unknown
chr1L:204003003..204003027 21/25 unknown
chr5L:83347199..83347223 21/25 unknown
chr6S:14541096..14541120 21/25 unknown
tropicalis 10.0 Chr3:102185240..102185264 25/25 Antisense target mapk6
Chr1:76692615..76692639 21/25 unknown
Chr9:49251913..49251937 21/25 unknown
Publications
First: The atypical mitogen-activated protein kinase ERK3 is essential for establishment of epithelial architecture., J Biol Chem 2018                                        
Most recent:
View All Papers