Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756455

Morpholino Name: tfap2a MO4
Synonyms: TFAP2A MO1
mRNA Target: tfap2a

Morpholino Type: uncategorized morpholino
Sequence:
5' GCGATCCTGCCATTCCCCCATTTTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' TAAAATGGGGGAATGGCAGGTGAGA 3' |||||||||||||||||||| | 3' ATTTTACCCCCTTACCGTCCTAGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13268:163906..163930 21/25 unknown
Scaffold167347:3513783..3513807 21/25 Sense off-target Xelaev16019118m
Scaffold44546:239564..239588 21/25 Antisense off-target tfap2a-a
Scaffold90041:5957847..5957871 21/25 unknown
tropicalis 7.1 scaffold_6:59771989..59772013 21/25 Antisense target tfap2a
Publications
First: The atypical mitogen-activated protein kinase ERK3 is essential for establishment of epithelial architecture., J Biol Chem 2018                                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556