Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756559

Morpholino Name: oat.1.L
Synonyms:
mRNA Target: oat

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TGGATTAGTTTGGAAAGCATTCTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16863:8506467..8506491 25/25 Antisense off-target oat.1
Scaffold7555:9064583..9064607 25/25 Antisense off-target oat.2
Scaffold35184:121316..121340 21/25 unknown
Scaffold64637:385013..385037 21/25 unknown
Scaffold73623:3596730..3596754 21/25 unknown
tropicalis 7.1 scaffold_7:18538206..18538230 25/25 Antisense off-target oat.1
scaffold_127:58284..58308 24/25 Antisense off-target oat.2
scaffold_2:47257437..47257461 21/25 Sense off-target frmpd4
scaffold_2:59209780..59209804 21/25 unknown
scaffold_33:167429..167453 21/25 unknown
scaffold_1:206306568..206306592 21/25 unknown
Publications
First: Ornithine-δ-Aminotransferase Inhibits Neurogenesis During Xenopus Embryonic Development., Invest Ophthalmol Vis Sci 2015    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556