Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756561

Morpholino Name: hnf1b MO1
Synonyms:
mRNA Target: hnf1b

Morpholino Type: uncategorized morpholino
Sequence:
5' CCTCGCTGTGAACAAAACACAAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23 21/23
genomic

MO
5' TTTGTGTTTTGTTCACAGCGAGG 3' ||||||||||||||||||||||| 3' AAACACAAAACAAGTGTCGCTCC 5' 5' TATATGTTTTGTTCACAGCGAGG 3' | | ||||||||||||||||||| 3' AAACACAAAACAAGTGTCGCTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:62379142..62379164 23/23 Antisense target hnf1b.L
chr2S:60112874..60112896 21/23 Antisense target hnf1b.S
chr5L:100245129..100245151 20/23 Sense off-target p3h2.L
chr2S:153799795..153799817 19/23 Sense off-target picalm.S
chr8S:63410750..63410772 19/23 Sense off-target aff2.S
chr1L:181281982..181282004 19/23 Antisense off-target LOC108695679 [provisional:adgrv1]
chr1L:48167132..48167154 19/23 Sense off-target mnd1.L
chr1S:16102879..16102901 19/23 Sense off-target LOC108704166
chr2L:122490111..122490133 19/23 Antisense off-target LOC108708487 [provisional:gpc6]
chr2S:11969375..11969397 20/23 unknown
chr9_10L:49707266..49707288 19/23 unknown
chr9_10S:90679678..90679700 19/23 unknown
Scaffold19:6593704..6593726 19/23 unknown
tropicalis 10.0 Chr3:53366147..53366169 20/23 Sense off-target tmtc2
Chr7:54972707..54972729 19/23 Sense off-target samd8
Chr1:83460400..83460422 20/23 unknown
Chr5:121688288..121688310 20/23 unknown
Chr7:77340334..77340356 20/23 unknown
Chr8:85234854..85234876 19/23 unknown
Publications
First: Retinoic acid-induced expression of Hnf1b and Fzd4 is required for pancreas development in Xenopus laevis., Development 2018                                    
Most recent:
View All Papers