Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756561

Morpholino Name: hnf1b MO1
Synonyms:
mRNA Target: hnf1b

Morpholino Type: uncategorized morpholino
Sequence:
5' CCTCGCTGTGAACAAAACACAAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' TTTGTGTTTTGTTCACAGCGAGG 3' ||||||||||||||||||||||| 3' AAACACAAAACAAGTGTCGCTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold2841:162522..162544 23/23 Antisense target hnf1b
Scaffold107111:241702..241724 21/23 Antisense off-target Xelaev16001927m
Scaffold11316:2854938..2854960 20/23 unknown
Scaffold30987:5328996..5329018 20/23 Sense off-target Xelaev16041772m
Scaffold1187:6048370..6048392 19/23 Antisense off-target Xelaev16004888m
Scaffold146311:2734562..2734584 19/23 Sense off-target Xelaev16013595m
Scaffold15436:2891647..2891669 19/23 unknown
Scaffold18239:1418737..1418759 19/23 Sense off-target Xelaev16022576m
Scaffold21603:1044866..1044888 19/23 unknown
Scaffold23403:7081592..7081614 19/23 unknown
Scaffold61741:353135..353157 19/23 Sense off-target mnd1
Scaffold78860:3987828..3987850 19/23 unknown
Scaffold80536:215897..215919 19/23 unknown
tropicalis 7.1 scaffold_1:143520161..143520183 20/23 unknown
scaffold_494:24193..24215 20/23 unknown
scaffold_5:2480772..2480794 20/23 unknown
scaffold_674:6705..6727 20/23 unknown
scaffold_7:58795945..58795967 19/23 unknown
scaffold_8:59212140..59212162 19/23 unknown
Publications
First: Retinoic acid-induced expression of Hnf1b and Fzd4 is required for pancreas development in Xenopus laevis., Development 2018                                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556