Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756564

Morpholino Name: kdm3a MO1
Synonyms: kdm3a MO
mRNA Target: kdm3a

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGAGTGAGCACCATCTTCACTGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' GCCAGCAAAGATGGTGCTCACGCAG 3' ||||| |||||||||||||| ||| 3' CGGTCACTTCTACCACGAGTGAGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1168:1021786..1021810 25/25 Antisense off-target kdm3a-b
Scaffold227467:352..376 23/25 unknown
tropicalis 7.1 scaffold_1:202060379..202060403 22/25 Antisense target kdm3a
scaffold_2:106586635..106586659 21/25 unknown
Publications
First: KDM3A-mediated demethylation of histone H3 lysine 9 facilitates the chromatin binding of Neurog2 during neurogenesis., Development 2017                            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556