Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19776740

Morpholino Name: hdac1 MO2
Synonyms:
mRNA Target: hdac1

Morpholino Type: translation blocking morpholino
Sequence:
5' GAGTCAGCGCCATTTTCCTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 20/21
genomic

MO
5' GAAGGAAAATGGCGCTGAGTC 3' |||||||||||||||||| || 3' CTTCCTTTTACCGCGACTGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold298574:92468..92488 21/21 Antisense off-target hdac1-a
Scaffold166674:3177750..3177770 20/21 Antisense off-target hdac1-b
Scaffold25212:1425461..1425481 19/21 unknown
Scaffold100253:1675190..1675210 18/21 unknown
Scaffold23403:1463588..1463608 18/21 unknown
Scaffold245044:3299264..3299284 18/21 unknown
Scaffold26121:107..127 18/21 unknown
Scaffold305513:90471..90491 18/21 unknown
Scaffold46073:1206513..1206533 18/21 Sense off-target Xelaev16055785m
Scaffold7000:704599..704619 18/21 unknown
Scaffold7749:22930..22950 18/21 Sense off-target Xelaev16072840m
tropicalis 7.1 scaffold_2:10784325..10784345 20/21 Antisense target hdac1
scaffold_2:10784325..10784345 20/21 Sense off-target tor2a
scaffold_6:63751420..63751440 18/21 Antisense off-target serpinb5
scaffold_7:65751184..65751204 18/21 unknown
scaffold_8:78520169..78520189 18/21 unknown
scaffold_8:83040591..83040611 18/21 unknown
scaffold_9:49152695..49152715 18/21 unknown
scaffold_5:83031854..83031874 17/21 unknown
Publications
First: Histone deacetylase activity has an essential role in establishing and maintaining the vertebrate neural crest., Development 2018                            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556