Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19777591

Morpholino Name: gli2 MO2
Synonyms:
mRNA Target: gli2

Morpholino Type: uncategorized morpholino
Sequence:
5' CAGAACGCAGGTAATGCTCCATGTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' CACATGGAGCATTACCTGCGCTCCG 3' |||||||||||||||||||| || | 3' GTGTACCTCGTAATGGACGCAAGAC 5' 5' CACATGGAGCATTACCTGCGTTCTG 3' ||||||||||||||||||||||||| 3' GTGTACCTCGTAATGGACGCAAGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold163806:6718295..6718319 25/25 Antisense target gli2
Scaffold84188:2248755..2248779 25/25 Antisense off-target Xelaev16075844m
Scaffold267727:1041834..1041858 22/25 Sense off-target mecom-b
Scaffold115919:617657..617681 21/25 Antisense off-target Xelaev16004376m
Scaffold155039:394882..394906 21/25 unknown
tropicalis 7.1 scaffold_385:53869..53893 23/25 Antisense target gli2
Publications
First: Gli2 is required for the induction and migration of Xenopus laevis neural crest., Mech Dev 2018                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556