Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19777593

Morpholino Name: katnal2 MO1
Synonyms:
mRNA Target: katnal2

Morpholino Type: uncategorized morpholino
Sequence:
5' CACTGTTAGTCAGGGAACAAGGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGCCTTGTTCCCTGACTAACAGTG 3' ||||||||||||||||||||||||| 3' TACGGAACAAGGGACTGATTGTCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_1:6820852..6820876 25/25 Antisense target katnal2
Publications
First: Katanin-like protein Katnal2 is required for ciliogenesis and brain development in Xenopus embryos., Dev Biol 2018                                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556