Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19777959

Morpholino Name: mc4r MO1
Synonyms: mc4r-Mo1
Target mRNA: mc4r

Morpholino Type: uncategorized morpholino
Sequence: 5' ATACTCAGCGATGACAAACATATGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCATATGTTTGTCATCGCTGAGTAT 3' ||||||||||||||||||||||||| 3' CGTATACAAACAGTAGCGACTCATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:82099180..82099204 25/25 Antisense target mc4r.L
chr8L:42322119..42322143 21/25 Sense off-target LOC100488567.L
chr5L:28099463..28099487 21/25 unknown
chr7S:46985737..46985761 21/25 unknown
Publications
First: Melanocortin Receptor 4 Signaling Regulates Vertebrate Limb Regeneration., Dev Cell 2018                                
Most recent:
View All Papers