Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19777960

Morpholino Name: mc4r MO2
Synonyms: mc4r-Mo2
Target mRNA: mc4r

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GCGTAAAATTCATTATTCCCATCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 24/25
genomic

MO
5' ATGGTGGGAATAATGAATTTCACGC 3' ||| |||||||||||||||| |||| 3' TACTACCCTTATTACTTAAAATGCG 5' 5' ATGATGGGAATAATGAATTTTACGC 3' ||||||||||||||||||||||||| 3' TACTACCCTTATTACTTAAAATGCG 5' 5' ATGATGGGAATAATGAATGTTACGC 3' |||||||||||||||||| |||||| 3' TACTACCCTTATTACTTAAAATGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:82099157..82099181 25/25 Antisense target mc4r.L
chr6S:68321724..68321748 24/25 Antisense target mc4r.S
chr3L:91600552..91600576 21/25 unknown
tropicalis 10.0 Chr6:84343825..84343849 23/25 Antisense target mc4r
Chr1:3973757..3973781 21/25 Antisense off-target LOC116408410
Chr1:3973757..3973781 21/25 Antisense off-target Xetrov107000081m.g
Chr1:17567960..17567984 21/25 unknown
Publications
First: Melanocortin Receptor 4 Signaling Regulates Vertebrate Limb Regeneration., Dev Cell 2018                                
Most recent:
View All Papers