Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19778017

Morpholino Name: ascl1 MO6
Synonyms: Ascl1a Moa2
mRNA Target: ascl1

Morpholino Type: uncategorized morpholino
Sequence:
5' GTTCCCTGGCTCTAGCTCTGTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23 22/23
genomic

MO
5' GCACAGAGCTAGAGCCAGGGAAC 3' ||||||||||||||||||||||| 3' CGTGTCTCGATCTCGGTCCCTTG 5' 5' GCACAGAGCTAGAGGCAGGGAAC 3' |||||||||||||| |||||||| 3' CGTGTCTCGATCTCGGTCCCTTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:42576698..42576720 23/23 Antisense target ascl1.L
chr3S:95729436..95729458 22/23 Antisense target ascl1.S
chr5L:155092080..155092102 20/23 Antisense off-target rab10.L
chr1S:132899190..132899212 20/23 Sense off-target aacs.S
chr7S:70280994..70281016 20/23 Sense off-target megf6.S
chr3L:19797657..19797679 19/23 Antisense off-target ik.L
chr7S:84330985..84331007 19/23 unknown
chr8L:32830350..32830372 19/23 Antisense off-target diaph2.L
chr9_10S:10197347..10197369 19/23 Antisense off-target nfatc2.S
tropicalis 10.0 Chr1:15076022..15076044 19/23 unknown
Chr4:16452255..16452277 19/23 Sense off-target ppfibp2
Chr4:48090914..48090936 19/23 Antisense off-target LOC101733881
Chr5:77588997..77589019 19/23 unknown
Chr6:146067186..146067208 19/23 unknown
Chr7:117838240..117838262 19/23 unknown
Publications
First: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
Most recent:
View All Papers