Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19778017

Morpholino Name: ascl1 MO6
Synonyms: Ascl1a Moa2
mRNA Target: ascl1

Morpholino Type: uncategorized morpholino
Sequence:
5' GTTCCCTGGCTCTAGCTCTGTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' GCACAGAGCTAGAGCCAGGGAAC 3' ||||||||||||||||||||||| 3' CGTGTCTCGATCTCGGTCCCTTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold18184:4472125..4472147 23/23 Antisense target ascl1
Scaffold5925:8048213..8048235 22/23 Antisense off-target Xelaev16064810m
Scaffold167265:707318..707340 20/23 Sense off-target Xelaev16019000m
Scaffold191023:924904..924926 20/23 Antisense off-target Xelaev16024176m
Scaffold208071:6463198..6463220 20/23 unknown
Scaffold88028:57..79 20/23 unknown
Scaffold14557:4056547..4056569 19/23 Antisense off-target Xelaev16013268m
Scaffold15893:371257..371279 19/23 Antisense off-target ik
Scaffold167347:839029..839051 19/23 unknown
Scaffold394073:475..497 19/23 unknown
tropicalis 7.1 scaffold_4:121528133..121528155 20/23 unknown
scaffold_4:16146781..16146803 19/23 unknown
scaffold_4:44574543..44574565 19/23 unknown
scaffold_5:50335351..50335373 19/23 unknown
scaffold_7:115270833..115270855 19/23 unknown
scaffold_7:4215311..4215333 19/23 unknown
Publications
First: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556