Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19778018

Morpholino Name: ascl1 MO7
Synonyms: Ascl1a spMO, ascl1a splicing MO
mRNA Target: ascl1

Morpholino Type: splice blocking morpholino
Sequence:
5' GATGGAGGCAACTCACCTGCTACTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' GAGTAGCAGGTGAGTTGCCTCCATC 3' ||||||||||||||||||||||||| 3' CTCATCGTCCACTCAACGGAGGTAG 5' 5' GAGAAGCAGGTCAGTTGCCTCCATC 3' ||| ||||||| ||||||||||||| 3' CTCATCGTCCACTCAACGGAGGTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:42575933..42575957 25/25 Antisense target ascl1.L
chr3S:95730169..95730193 23/25 Antisense target ascl1.S
chr7L:31598181..31598205 22/25 Antisense off-target rpp30.L
chr1S:127138267..127138291 21/25 Sense off-target ypel1.S
chr6L:56568406..56568430 21/25 Antisense off-target sugct.L
tropicalis 10.0 Chr6:120019532..120019556 21/25 Antisense off-target slco5a1
Publications
First: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
Most recent: KDM3A-mediated demethylation of histone H3 lysine 9 facilitates the chromatin binding of Neurog2 during neurogenesis., Development 2017                            
View All Papers