Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19778018

Morpholino Name: ascl1 MO7
Synonyms: Ascl1a spMO, ascl1a splicing MO
mRNA Target: ascl1

Morpholino Type: splice blocking morpholino
Sequence:
5' GATGGAGGCAACTCACCTGCTACTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAGTAGCAGGTGAGTTGCCTCCATC 3' ||||||||||||||||||||||||| 3' CTCATCGTCCACTCAACGGAGGTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold18184:4472888..4472912 25/25 Antisense target ascl1
Scaffold5925:8048946..8048970 23/25 Antisense off-target Xelaev16064810m
Scaffold44558:1206136..1206160 22/25 Antisense off-target rpp30
Scaffold5228:1986085..1986109 21/25 unknown
Scaffold97703:1026846..1026870 21/25 Sense off-target Xelaev16080285m
tropicalis 7.1 scaffold_6:29725656..29725680 21/25 Antisense off-target slco5a1
Publications
First: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
Most recent: KDM3A-mediated demethylation of histone H3 lysine 9 facilitates the chromatin binding of Neurog2 during neurogenesis., Development 2017                            
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556