Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19778019

Morpholino Name: hdac1 MO3
Synonyms:
mRNA Target: hdac1

Morpholino Type: uncategorized morpholino
Sequence:
5' AAGACCTACTACTACTTTGACCGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold298574:92436..92460 25/25 Antisense off-target hdac1-a
Scaffold33905:1963507..1963531 21/25 Sense off-target Xelaev16044727m
Publications
First: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556