Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-21948139

Morpholino Name: mcidas MO1
Synonyms: mci multicilin MO1
Target mRNA: mcidas

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' AAAACGCTTTCCTTCTGTTCTGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 22/25 25/25
genomic

MO
5' ATGCAGAACAGAAGGAAAGCCTTTG 3' |||||||||||||||||||| ||| 3' TACGTCTTGTCTTCCTTTCGCAAAA 5' 5' ATGCAGAATAGAAGGAAAGCCTTTG 3' |||||||| ||||||||||| ||| 3' TACGTCTTGTCTTCCTTTCGCAAAA 5' 5' ATGCAGAACAGAAGGAAAGCGTTTT 3' ||||||||||||||||||||||||| 3' TACGTCTTGTCTTCCTTTCGCAAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:160505082..160505106 25/25 Antisense target mcidas.S
chr1L:195642468..195642492 22/25 Antisense target mcidas.L
chr1S:175544763..175544787 22/25 Sense off-target setbp1.S
chr2S:19153729..19153753 21/25 Sense off-target scaf4.S
chr5L:24440631..24440655 21/25 Sense off-target jag1.L
chr4S:13367154..13367178 21/25 unknown
chr6L:11432929..11432953 21/25 unknown
chr6S:9297965..9297989 21/25 unknown
tropicalis 10.0 Chr1:191667606..191667630 23/25 Antisense target mcidas
Chr3:111284189..111284213 22/25 Sense off-target agbl1
Chr3:117689667..117689691 21/25 Antisense off-target calml4
Chr9:38271771..38271795 21/25 Sense off-target litafd
Chr1:59238678..59238702 21/25 Sense off-target smarca5
Chr2:136045680..136045704 22/25 unknown
Chr2:85023450..85023474 21/25 unknown
Publications
First: Manipulating and Analyzing Cell Type Composition of the Xenopus Mucociliary Epidermis., Methods Mol Biol 2018  
Most recent:
View All Papers