Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-21948140

Morpholino Name: mcidas MO2
Synonyms: Mci-SPL MO, mci multicilin MO2
Target mRNA: mcidas

Morpholino Type: splice blocking morpholino
Sequence: 5' GTGCCAGTCACTCACCTGGTTGTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 23/25
genomic

MO
5' GAACAACCAGGTGAGTTACTTGCCC 3' |||||||||||||||| ||| || | 3' CTTGTTGGTCCACTCACTGACCGTG 5' 5' GAACAACCAGGTGAGTGACCTGCAC 3' ||||||||||||||||||| |||| 3' CTTGTTGGTCCACTCACTGACCGTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:195647155..195647179 23/25 Antisense target mcidas.L
Scaffold26051:213..237 25/25 Antisense off-target Xelaev18002015m
chr2S:158114573..158114597 22/25 Antisense off-target stim1.S
chr2L:173086688..173086712 21/25 Antisense off-target stim1.L
chr6S:64449791..64449815 22/25 unknown
tropicalis 10.0 Chr1:191671388..191671412 22/25 Antisense target mcidas
Chr6:14801855..14801879 21/25 Sense off-target kmt2c
Publications
First: Manipulating and Analyzing Cell Type Composition of the Xenopus Mucociliary Epidermis., Methods Mol Biol 2018  
Most recent:
View All Papers