Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22041474

Morpholino Name: ddx21 MO1
Synonyms: ddx21a MO
mRNA Target: ddx21

Morpholino Type: translation blocking morpholino
Sequence:
5' CTGCATCAGAAAATCATTACCTTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' ACAAGGTAATGATTTTCTGAGGCTG 3' |||||||||||||||||||| || | 3' TGTTCCATTACTAAAAGACTACGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold89040:104733..104757 25/25 Antisense off-target Xelaev16077609m
Scaffold233355:34554..34578 23/25 Antisense target ddx21
Scaffold30470:6042212..6042236 23/25 unknown
Scaffold179914:445390..445414 21/25 Sense off-target Xelaev16021863m
Scaffold42960:1425528..1425552 21/25 Sense off-target Xelaev16052625m
Scaffold58784:319614..319638 21/25 Sense off-target Xelaev16064014m
Scaffold94404:330707..330731 21/25 Antisense off-target slc12a5
tropicalis 7.1 scaffold_2:133479057..133479081 22/25 Sense off-target ctsc
Publications
First: Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders., Nature 2018  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556