Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22041477

Morpholino Name: tcof1 MO1
Synonyms: tcof1 translation blocker
mRNA Target: tcof1

Morpholino Type: translation blocking morpholino
Sequence:
5' GATCCCTCCACTTCCTTCATGATAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' GCAACATGAAGGAAGTGGAGGGATC 3' | | ||||||||||||||||||||| 3' CATAGTACTTCCTTCACCTCCCTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold187759:717419..717443 25/25 Antisense off-target Xelaev16023517m
Scaffold30987:4494104..4494128 21/25 unknown
tropicalis 7.1 scaffold_3:45240595..45240619 23/25 Antisense target tcof1
scaffold_9:72253819..72253843 21/25 unknown
Publications
First: Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders., Nature 2018  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556