Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22041478

Morpholino Name: tcof1 MO2
Synonyms: tcof1 splicing blocker
mRNA Target: tcof1

Morpholino Type: splice blocking morpholino
Sequence:
5' GCTGGTTTCTGATTTAACAGACACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold187759:703939..703963 25/25 Sense off-target Xelaev16023521m
Scaffold187759:703939..703963 25/25 Antisense off-target Xelaev16023517m
Scaffold155263:76746..76770 22/25 Sense off-target Xelaev16016243m
Scaffold1187:5245720..5245744 21/25 Sense off-target Xelaev16004876m
Scaffold12423:1752351..1752375 21/25 unknown
Scaffold267344:1132262..1132286 21/25 unknown
Scaffold275342:4856477..4856501 21/25 unknown
Scaffold360123:284691..284715 21/25 Sense off-target brca1
Scaffold58878:5821610..5821634 21/25 Sense off-target Xelaev16064306m
tropicalis 7.1 scaffold_2:23974863..23974887 21/25 unknown
scaffold_7:29386592..29386616 21/25 Antisense off-target hps1
scaffold_7:29388577..29388601 21/25 Sense off-target hps1
Publications
First: Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders., Nature 2018  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556