Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22041482

Morpholino Name: LOC100494211 MO1
Synonyms: Bighead.L MO
mRNA Target: loc100494211

Morpholino Type: uncategorized morpholino
Sequence:
5' ATATCCCGAGCCAAACTGTAGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36586:3617179..3617203 25/25 Antisense off-target Xelaev16047681m
Scaffold44061:3772039..3772063 23/25 Antisense off-target Xelaev16054429m
Scaffold69443:6809089..6809113 21/25 Antisense off-target Xelaev16068967m
Scaffold75417:5427883..5427907 21/25 unknown
Scaffold93416:4295224..4295248 21/25 unknown
tropicalis 7.1 scaffold_1:59249842..59249866 23/25 Antisense off-target unnamed
Publications
First: Bighead is a Wnt antagonist secreted by the Xenopus Spemann organizer that promotes Lrp6 endocytosis., Proc Natl Acad Sci U S A 2018  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556