Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22041778

Morpholino Name: rarg MO3
Synonyms: Rar gamma1.S
Target mRNA: rarg

Morpholino Type: uncategorized morpholino
Sequence: 5' CTAGCCAGTAGTTGTCTTGGAATCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGATTCCAAGACAACTACTGGCTAG 3' ||||||||||||||||||||||||| 3' TCTAAGGTTCTGTTGATGACCGATC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2S:129913265..129913289 25/25 Antisense target rarg.S
chr4L:56536749..56536773 22/25 unknown
chr3L:41580640..41580664 21/25 unknown
chr3S:96558724..96558748 21/25 unknown
Publications
First: RARγ is required for mesodermal gene expression prior to gastrulation in Xenopus., Development 2018                            
Most recent:
View All Papers