Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22060856

Morpholino Name: wdr5 MO4
Synonyms:
mRNA Target: wdr5

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CGGGTTTCTTTTCTTCTGTTGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGCAACAGAAGAAAAGAAACCCG 3' ||||||||||||||||||||||||| 3' TACCGTTGTCTTCTTTTCTTTGGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold251007:201060..201084 25/25 Antisense off-target wdr5-b
Scaffold255149:311386..311410 23/25 Antisense off-target wdr5-a
Scaffold104110:145051..145075 21/25 unknown
Scaffold131887:38781..38805 21/25 unknown
Scaffold135348:361554..361578 21/25 unknown
Scaffold151039:987099..987123 21/25 unknown
Scaffold195582:164981..165005 21/25 Antisense off-target Xelaev16024703m
Scaffold195582:37861..37885 21/25 unknown
Scaffold197662:467857..467881 21/25 Sense off-target cadm4
Scaffold251007:516993..517017 21/25 unknown
Scaffold276272:1159530..1159554 21/25 Antisense off-target Xelaev16037972m
Scaffold30987:3786312..3786336 21/25 Antisense off-target Xelaev16041741m
Scaffold393565:68534..68558 21/25 unknown
Scaffold66475:1305488..1305512 21/25 unknown
Scaffold78587:1184411..1184435 21/25 unknown
tropicalis 7.1 scaffold_8:3187654..3187678 25/25 Antisense target wdr5
scaffold_8:3189404..3189428 25/25 Antisense target wdr5
Publications
First: WDR5 Stabilizes Actin Architecture to Promote Multiciliated Cell Formation., Dev Cell 2018                                
Most recent: WDR5 regulates left-right patterning via chromatin-dependent and -independent functions., Development 2018                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556