Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22060856

Morpholino Name: wdr5 MO4
Synonyms:
Target mRNA: wdr5

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CGGGTTTCTTTTCTTCTGTTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 25/25
genomic

MO
5' ATGGCAACAGAAGAAAAGAAACCCG 3' ||||||||||||||||||||||||| 3' TACCGTTGTCTTCTTTTCTTTGGGC 5' 5' ATGGCAACGGAAGAAAAGAAACCGG 3' |||||||| |||||||||||||| | 3' TACCGTTGTCTTCTTTTCTTTGGGC 5' 5' ATGGCAACAGAAGAAAAGAAACCCG 3' ||||||||||||||||||||||||| 3' TACCGTTGTCTTCTTTTCTTTGGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:30232106..30232130 25/25 Antisense target wdr5.S
chr8L:5469095..5469119 23/25 Antisense target wdr5.L
chr3S:63986135..63986159 21/25 Sense off-target LOC108712343 [provisional:exoc4]
chr4L:83015613..83015637 21/25 Antisense off-target uqcrh.L
chr4S:28685947..28685971 21/25 Antisense off-target nkd1.S
chr5L:101787811..101787835 21/25 Antisense off-target mcf2l.2.L
chr7L:114422265..114422289 21/25 Sense off-target cadm4.L
chr8S:30548039..30548063 21/25 Antisense off-target garnl3.S
chr2L:168299535..168299559 21/25 unknown
chr2S:86370740..86370764 21/25 unknown
chr4S:28558827..28558851 21/25 unknown
chr5S:68593171..68593195 21/25 unknown
chr6L:152033512..152033536 21/25 unknown
chr7L:115454521..115454545 21/25 unknown
chr7L:82415410..82415434 21/25 unknown
tropicalis 10.0 Chr8:8202297..8202321 25/25 Antisense target wdr5
Publications
First: WDR5 Stabilizes Actin Architecture to Promote Multiciliated Cell Formation., Dev Cell 2018                                
Most recent: WDR5 regulates left-right patterning via chromatin-dependent and -independent functions., Development 2018                  
View All Papers