Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22060857

Morpholino Name: wdr5 MO5
Synonyms:
mRNA Target: wdr5

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TGCAAGAACAACTTGTGGCCGGATA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_4:7714669..7714693 21/25 unknown
Publications
First: WDR5 Stabilizes Actin Architecture to Promote Multiciliated Cell Formation., Dev Cell 2018                                
Most recent: WDR5 regulates left-right patterning via chromatin-dependent and -independent functions., Development 2018                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556