Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22060875

Morpholino Name: rax MO3
Synonyms:
mRNA Target: rax

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGTGCAGGTGCATTGAGGACCCTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' AAGGGTCCTCCATGCACCTGCACAG 3' |||||||||| |||||||||||||| 3' TTCCCAGGAGTTACGTGGACGTGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold51452:4372838..4372862 25/25 Antisense off-target rax-a
Scaffold52441:2507852..2507876 24/25 Antisense off-target rax-b
tropicalis 7.1 scaffold_1:18626480..18626504 24/25 Antisense target rax
Publications
First: Identification of retinal homeobox (rax) gene-dependent genes by a microarray approach: The DNA endoglycosylase neil3 is a major downstream component of the rax genetic pathway., Dev Dyn 2018                              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556