Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22060875

Morpholino Name: rax MO3
Synonyms:
Target mRNA: rax

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGTGCAGGTGCATTGAGGACCCTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genomic

MO
5' AAGGGTCCTCGATGCACCTGCACAG 3' |||||||||| |||||||||||||| 3' TTCCCAGGAGTTACGTGGACGTGTC 5' 5' AAGGGTCATCAATGCACCTGCACAG 3' ||||||| ||||||||||||||||| 3' TTCCCAGGAGTTACGTGGACGTGTC 5' 5' AAGGGTCCTCAATGCACCTGCACAG 3' ||||||||||||||||||||||||| 3' TTCCCAGGAGTTACGTGGACGTGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:169564605..169564629 25/25 Antisense target rax.S
chr1L:205726709..205726733 24/25 Antisense target rax.L
tropicalis 10.0 Chr1:201402395..201402419 24/25 Antisense target rax
Publications
First: Identification of retinal homeobox (rax) gene-dependent genes by a microarray approach: The DNA endoglycosylase neil3 is a major downstream component of the rax genetic pathway., Dev Dyn 2018                              
Most recent:
View All Papers