Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22060880

Morpholino Name: neil3 MO1
Synonyms:
Target mRNA: neil3

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGCCCGGACCCTCCACCATAATT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' AGTTATGGTGGAGGGTCCGGGCTGC 3' | ||||||||||||||||||||||| 3' TTAATACCACCTCCCAGGCCCGACG 5' 5' AATTATGGTGGAGGGTCCGGGCTGC 3' ||||||||||||||||||||||||| 3' TTAATACCACCTCCCAGGCCCGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:40734250..40734274 25/25 Antisense target neil3.L
tropicalis 10.0 Chr1:47309115..47309139 24/25 Antisense target neil3
Publications
First: Identification of retinal homeobox (rax) gene-dependent genes by a microarray approach: The DNA endoglycosylase neil3 is a major downstream component of the rax genetic pathway., Dev Dyn 2018                              
Most recent:
View All Papers