Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22061196

Morpholino Name: fam183b MO1
Synonyms: TBMO
mRNA Target: fam183b

Morpholino Type: translation blocking morpholino
Sequence:
5' TTAGGCTCGTTTCCAGGGCAACCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold67962:351830..351854 25/25 Antisense off-target Xelaev16068401m
Scaffold8129:6888797..6888821 22/25 Sense off-target c1ql4
Scaffold14978:3033978..3034002 21/25 Sense off-target Xelaev16014414m
tropicalis 7.1 scaffold_1211:6737..6761 23/25 unknown
scaffold_4:98219166..98219190 23/25 unknown
scaffold_2:78373448..78373472 22/25 Sense off-target c1ql4
Publications
First: The evolutionary conserved FOXJ1 target gene Fam183b is essential for motile cilia in Xenopus but dispensable for ciliary function in mice., Sci Rep 2018              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556