Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22061326

Morpholino Name: Rpsa MO1
Synonyms:
mRNA Target: rpsa

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' CCGGACATTGTGAGTTACCCCTTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24
genomic

MO
5' AAAGGGGTAACTCACAATGTCCGG 3' |||||||||||||||||||||||| 3' TTTCCCCATTGAGTGTTACAGGCC 5' 5' AAAGGGGTAACTCACAATGTCCGG 3' |||||||||||||||||||||||| 3' TTTCCCCATTGAGTGTTACAGGCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold23165:4152186..4152209 24/24 Antisense target rpsa
Scaffold245044:6901713..6901736 24/24 Antisense off-target Xelaev16032784m
Scaffold228191:491..514 20/24 unknown
Scaffold395028:547568..547591 20/24 Antisense off-target Xelaev16050230m
tropicalis 7.1 scaffold_4:80111094..80111117 24/24 Antisense target rpsa
scaffold_7:49882252..49882275 20/24 Antisense off-target c15orf59
Publications
First: RPSA, a candidate gene for isolated congenital asplenia, is required for pre-rRNA processing and spleen formation in Xenopus., Development 2018  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556