Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22061353

Morpholino Name: prdx5 MO1
Synonyms:
mRNA Target: prdx5

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGATACCGGGATACGAAGAGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGCTCTTCGTATCCCGGTATCAT 3' ||||||||||||||||||||||||| 3' TACCGAGAAGCATAGGGCCATAGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold2589:2417157..2417181 25/25 Antisense target prdx5
Scaffold103933:65957..65981 21/25 unknown
Publications
First: Peroxiredoxin5 Controls Vertebrate Ciliogenesis by Modulating Mitochondrial Reactive Oxygen Species., Antioxid Redox Signal 2019    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556