Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063230

Morpholino Name: tek MO1
Synonyms: tie2 MO
mRNA Target: tek

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' ATGGTTTCCACAATCTCTCCATCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1915:2173555..2173579 25/25 Antisense off-target Xelaev16024231m
Scaffold119172:933..957 24/25 Sense off-target Xelaev16005070m
Scaffold171879:1335610..1335634 24/25 Antisense off-target Xelaev16020635m
Scaffold58038:5265463..5265487 22/25 unknown
Scaffold89040:687696..687720 22/25 unknown
tropicalis 7.1 scaffold_7:27069655..27069679 23/25 unknown
scaffold_1:70144349..70144373 21/25 Antisense off-target psma5
Publications
First: Calmodulin Mediates Ca2+-Dependent Inhibition of Tie2 Signaling and Acts as a Developmental Brake During Embryonic Angiogenesis., Arterioscler Thromb Vasc Biol 2016  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556