Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063230

Morpholino Name: tek MO1
Synonyms: tie2 MO
Target mRNA: tek

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' ATGGTTTCCACAATCTCTCCATCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGGATGGAGAGATTGTGGAAACCAT 3' ||||||||||||||||||||||||| 3' ACCTACCTCTCTAACACCTTTGGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 10.0 Chr1:122298790..122298814 25/25 Antisense target tek
Chr9:50248063..50248087 21/25 Antisense off-target LOC100490370
Publications
First: Calmodulin Mediates Ca2+-Dependent Inhibition of Tie2 Signaling and Acts as a Developmental Brake During Embryonic Angiogenesis., Arterioscler Thromb Vasc Biol 2016  
Most recent:
View All Papers