Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063357

Morpholino Name: gja1 MO1
Synonyms: Cx43MO1
mRNA Target: gja1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TTCCTAAGGCACTCCAGTCACCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGGTGACTGGAGTGCCTTAGGAA 3' ||||||||||||||||||||||||| 3' TACCCACTGACCTCACGGAATCCTT 5' 5' ATGGGTGACTGGAGTGCCTTAGGAA 3' ||||||||||||||||||||||||| 3' TACCCACTGACCTCACGGAATCCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold54140:774613..774637 25/25 Antisense off-target Xelaev16061678m
Scaffold6529:1899006..1899030 25/25 Antisense target gja1
Scaffold120240:3823089..3823113 21/25 unknown
Scaffold17434:5259884..5259908 21/25 unknown
tropicalis 7.1 scaffold_5:54607704..54607728 25/25 Antisense target gja1
Publications
First: Gap junction protein Connexin-43 is a direct transcriptional regulator of N-cadherin in vivo., Nat Commun 2018  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556