Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063541

Morpholino Name: tut4 MO1
Synonyms: xTUT4S
mRNA Target: tut4

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TTACAGGCTTAGAGACACCTTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Terminal Uridylyltransferases Execute Programmed Clearance of Maternal Transcriptome in Vertebrate Embryos., Mol Cell 2018        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556