Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063541

Morpholino Name: tut4 MO1
Synonyms: xTUT4S
Target mRNA: tut4

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TTACAGGCTTAGAGACACCTTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 23/25 25/25
genomic

MO
5' ATGGAAGGTGTCCCTAAGCCTGTAA 3' |||||||||||| |||||||||||| 3' TACCTTCCACAGAGATTCGGACATT 5' 5' ATGGAAGGTGTTCCTAAGCCTGTAA 3' ||||||||||| |||||||||||| 3' TACCTTCCACAGAGATTCGGACATT 5' 5' ATGGAAGGTGTCTCTAAGCCTGTAA 3' ||||||||||||||||||||||||| 3' TACCTTCCACAGAGATTCGGACATT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:70525447..70525471 25/25 Antisense target tut4.S
chr4L:86675158..86675182 23/25 Antisense target tut4.L
tropicalis 10.0 Chr4:96733184..96733208 24/25 Antisense target tut4
Chr1:178890824..178890848 21/25 Sense off-target adgrv1
Chr3:37334542..37334566 21/25 unknown
Publications
First: Terminal Uridylyltransferases Execute Programmed Clearance of Maternal Transcriptome in Vertebrate Embryos., Mol Cell 2018        
Most recent:
View All Papers