Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063542

Morpholino Name: tut4 MO2
Synonyms: xTUT4L
Target mRNA: tut4

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TTACAGGCTTAGGAACACCTTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' ATGGAAGGTGTCCCTAAGCCTGTAA 3' ||||||||||| ||||||||||||| 3' TACCTTCCACAAGGATTCGGACATT 5' 5' ATGGAAGGTGTTCCTAAGCCTGTAA 3' ||||||||||||||||||||||||| 3' TACCTTCCACAAGGATTCGGACATT 5' 5' ATGGAAGGTGTCTCTAAGCCTGTAA 3' ||||||||||| |||||||||||| 3' TACCTTCCACAAGGATTCGGACATT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:86675158..86675182 25/25 Antisense target tut4.L
chr4S:70525447..70525471 23/25 Antisense target tut4.S
chr3S:11786968..11786992 21/25 unknown
tropicalis 10.0 Chr4:96733184..96733208 24/25 Antisense target tut4
Publications
First: Terminal Uridylyltransferases Execute Programmed Clearance of Maternal Transcriptome in Vertebrate Embryos., Mol Cell 2018        
Most recent:
View All Papers