Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063544

Morpholino Name: tut7 MO2
Synonyms: xTUT7L
Target mRNA: tut7

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CTTGTTTGGCAGCATCCCCCATTTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' AAAATGGGGGATGCTGCCAAACAAG 3' ||||||||||||||||||||||||| 3' TTTTACCCCCTACGACGGTTTGTTC 5' 5' AAAATGGGGGATGCTGCCAAACAAG 3' ||||||||||||||||||||||||| 3' TTTTACCCCCTACGACGGTTTGTTC 5' 5' AAAATGGGGGATGCTGCCAAACAAG 3' ||||||||||||||||||||||||| 3' TTTTACCCCCTACGACGGTTTGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:133057000..133057024 25/25 Antisense target tut7.L
chr1S:109995001..109995025 25/25 Antisense target tut7.S
tropicalis 10.0 Chr1:134972512..134972536 25/25 Antisense target tut7
Chr9:61610858..61610882 21/25 Sense off-target col18a1
Publications
First: Terminal Uridylyltransferases Execute Programmed Clearance of Maternal Transcriptome in Vertebrate Embryos., Mol Cell 2018        
Most recent:
View All Papers