Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063546

Morpholino Name: tut7 MO3
Synonyms: xTUT7S
Target mRNA: tut7

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' ACTGCAGACAAAATCATTCCTGTTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 24/25 25/25
genomic

MO
5' TAGCATTAATGATTTTGTCTGCAAT 3' || || |||||||||||||||| | 3' ATTGTCCTTACTAAAACAGACGTCA 5' 5' TAACAGGAGTGATTTTGTCTGCAGT 3' |||||||| |||||||||||||||| 3' ATTGTCCTTACTAAAACAGACGTCA 5' 5' TAACAGGAATGATTTTGTCTGCAGT 3' ||||||||||||||||||||||||| 3' ATTGTCCTTACTAAAACAGACGTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:109995037..109995061 25/25 Antisense target tut7.S
chr1L:133057032..133057056 24/25 Antisense target tut7.L
chr1L:136906924..136906948 21/25 Antisense off-target auh.L
tropicalis 10.0 Chr1:134972541..134972565 21/25 Antisense target tut7
Chr8:123610701..123610725 21/25 unknown
Publications
First: Terminal Uridylyltransferases Execute Programmed Clearance of Maternal Transcriptome in Vertebrate Embryos., Mol Cell 2018        
Most recent:
View All Papers