Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063788

Morpholino Name: strap MO1
Synonyms:
mRNA Target: strap

Morpholino Type: uncategorized morpholino
Sequence:
5' CCACTAGCGAGGGCTTCATGTCAAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14696:646808..646832 25/25 Antisense off-target Xelaev16013998m
Scaffold152894:1271168..1271192 21/25 unknown
Scaffold26505:2296949..2296973 21/25 unknown
tropicalis 7.1 scaffold_3:99293829..99293853 21/25 unknown
Publications
First: Serine Threonine Kinase Receptor-Associated Protein Deficiency Impairs Mouse Embryonic Stem Cells Lineage Commitment Through CYP26A1-Mediated Retinoic Acid Homeostasis., Stem Cells 2018                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556