Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063810

Morpholino Name: fbxl17 MO1
Synonyms:
mRNA Target: fbxl17

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TTCTTGCGCTTGCACACCATGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' GACATGGTGTGCAAGCGCAAGAA 3' ||||||||||||||||||||||| 3' CTGTACCACACGTTCGCGTTCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1187:829568..829590 23/23 Antisense off-target Xelaev16004789m
Scaffold18823:718670..718692 19/23 Sense off-target Xelaev16023646m
Scaffold36364:5681918..5681940 19/23 Antisense off-target Xelaev16047398m
Scaffold4363:329598..329620 19/23 Antisense off-target Xelaev16053929m
tropicalis 7.1 scaffold_1:32475547..32475569 23/23 Antisense target fbxl17
scaffold_9:11223011..11223033 21/23 unknown
Publications
First: Dimerization quality control ensures neuronal development and survival., Science 2018  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556