Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063811

Morpholino Name: fbxl17 MO2
Synonyms:
mRNA Target: fbxl17

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence:
5' AGTTTTGTCCCACTATACCTTGAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' GCTCAAGGTATAGTGGGACAAAGCG 3' |||||||||||||||||||||| | 3' CGAGTTCCATATCACCCTGTTTTGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1187:831007..831031 25/25 Antisense off-target Xelaev16004789m
tropicalis 7.1 scaffold_1:32474715..32474739 23/25 Antisense target fbxl17
scaffold_1:119942070..119942094 21/25 unknown
scaffold_1:197059663..197059687 21/25 unknown
scaffold_5:99868055..99868079 21/25 unknown
Publications
First: Dimerization quality control ensures neuronal development and survival., Science 2018  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556