Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063813

Morpholino Name: fbxl17 MO4
Synonyms:
mRNA Target: fbxl17

Morpholino Type: splice blocking morpholino (E2-I2)
Sequence:
5' CTTGTTTTACTACACAGTACCTGCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1187:835127..835151 25/25 Antisense off-target Xelaev16004789m
Scaffold110844:212547..212571 22/25 unknown
Scaffold294734:567260..567284 22/25 Sense off-target Xelaev16039498m
Scaffold261090:44932..44956 21/25 Sense off-target hmbs.2
Scaffold52352:1334645..1334669 21/25 unknown
tropicalis 7.1 scaffold_1:112451297..112451321 21/25 Antisense off-target dgkq
scaffold_5:64735490..64735514 21/25 Sense off-target phactr2
scaffold_5:97734945..97734969 21/25 unknown
scaffold_7:108832873..108832897 21/25 Sense off-target ccdc63
scaffold_8:40685577..40685601 21/25 unknown
Publications
First: Dimerization quality control ensures neuronal development and survival., Science 2018  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556