Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063815

Morpholino Name: kbtbd8 MO3
Synonyms:
mRNA Target: kbtbd8

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GTGCAGCCATTCTCCTCCTCCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' GAGGAGGAGGAGAATGGCTGCAC 3' ||||||||||||||||||||||| 3' CTCCTCCTCCTCTTACCGACGTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold154579:1825840..1825862 23/23 Antisense off-target Xelaev16015908m
Scaffold34527:4119803..4119825 23/23 unknown
Scaffold16807:11842769..11842791 20/23 unknown
Scaffold21980:2096463..2096485 20/23 Sense off-target Xelaev16028479m
Scaffold40963:795415..795437 20/23 unknown
Scaffold42281:432227..432249 20/23 Antisense off-target znhit3
Scaffold42960:5268940..5268962 20/23 unknown
Scaffold57559:2330019..2330041 20/23 Sense off-target Xelaev16063403m
Scaffold7045:173573..173595 20/23 unknown
Scaffold79772:223089..223111 20/23 Sense off-target Xelaev16073860m
Scaffold163107:238165..238187 19/23 unknown
Scaffold102974:4386772..4386794 19/23 Antisense off-target Xelaev16000608m
Scaffold124037:1185..1207 19/23 unknown
Scaffold12518:14655058..14655080 19/23 Antisense off-target Xelaev16007444m
Scaffold14557:917694..917716 19/23 Antisense off-target Xelaev16013190m
Scaffold150991:946917..946939 19/23 unknown
Scaffold188330:410..432 19/23 unknown
Scaffold19985:1167507..1167529 19/23 Antisense off-target Xelaev16025346m
Scaffold21603:7743145..7743167 19/23 unknown
Scaffold24235:1371989..1372011 19/23 unknown
Scaffold256647:1802515..1802537 19/23 Antisense off-target Xelaev16034799m
Scaffold36364:1086080..1086102 19/23 Antisense off-target Xelaev16047295m
Scaffold45784:2584253..2584275 19/23 Antisense off-target cox20
Scaffold52352:5685..5707 19/23 unknown
Scaffold61609:2554863..2554885 19/23 Antisense off-target znf462
Scaffold75417:6926403..6926425 19/23 Antisense off-target Xelaev16072138m
Scaffold81122:219245..219267 19/23 unknown
Scaffold90041:205646..205668 19/23 Antisense off-target Xelaev16077931m
tropicalis 7.1 scaffold_4:132176012..132176034 23/23 Antisense target kbtbd8
scaffold_1:44823967..44823989 21/23 unknown
scaffold_6:16733910..16733932 20/23 unknown
scaffold_1:214639010..214639032 19/23 unknown
scaffold_10:30904932..30904954 19/23 Antisense off-target ppp1r1b
scaffold_2:31387836..31387858 19/23 Antisense off-target tusc5
scaffold_3b:2104586..2104608 19/23 unknown
scaffold_74:207649..207671 19/23 unknown
scaffold_8:56995041..56995063 19/23 unknown
Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556