Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22064111

Morpholino Name: nagk MO1
Synonyms:
mRNA Target: nagk

Morpholino Type: uncategorized morpholino
Sequence:
5' CCCCCATACACAGCAGCCATCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' GAGATGGCTGCTGTGTATGGGGG 3' ||||||||||||||||||||||| 3' CTCTACCGACGACACATACCCCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold298995:95461..95483 23/23 Antisense target nagk
Scaffold155263:48511..48533 21/23 Antisense off-target Xelaev16016243m
Scaffold33104:958318..958340 20/23 Sense off-target Xelaev16043878m
Scaffold34527:3776490..3776512 20/23 unknown
Scaffold14557:7371664..7371686 19/23 Sense off-target Xelaev16013375m
Scaffold160841:87280..87302 19/23 Antisense off-target Xelaev16017510m
Scaffold161773:496380..496402 19/23 Antisense off-target Xelaev16017860m
Scaffold161773:496380..496402 19/23 Sense off-target Xelaev16017858m
Scaffold229341:380421..380443 19/23 Antisense off-target Xelaev16029685m
Scaffold247724:3271879..3271901 19/23 unknown
Scaffold27161:6741454..6741476 19/23 Antisense off-target Xelaev16037141m
Scaffold31653:759180..759202 19/23 unknown
Scaffold41477:517171..517193 19/23 Antisense off-target Xelaev16052189m
Scaffold4754:1148128..1148150 19/23 unknown
Scaffold48114:2611452..2611474 19/23 unknown
Scaffold54336:326141..326163 19/23 Antisense off-target Xelaev16061961m
Scaffold55171:865721..865743 19/23 Sense off-target best2-a
Scaffold96659:4908505..4908527 19/23 Antisense off-target Xelaev16079976m
tropicalis 7.1 scaffold_1:146295504..146295526 20/23 Antisense off-target mmrn1
scaffold_1:194839040..194839062 20/23 unknown
scaffold_1:41318729..41318751 20/23 unknown
scaffold_1:73353913..73353935 20/23 Sense off-target anks1a
scaffold_1:95371242..95371264 20/23 unknown
scaffold_10:20957676..20957698 20/23 unknown
scaffold_10:8896661..8896683 20/23 unknown
scaffold_128:230653..230675 20/23 unknown
scaffold_128:230724..230746 20/23 unknown
scaffold_128:230742..230764 20/23 unknown
scaffold_152:5403..5425 20/23 unknown
scaffold_177:70872..70894 20/23 unknown
scaffold_177:70907..70929 20/23 unknown
scaffold_177:70996..71018 20/23 unknown
scaffold_177:71049..71071 20/23 unknown
scaffold_177:71119..71141 20/23 unknown
scaffold_2:22920078..22920100 20/23 unknown
scaffold_2:27156615..27156637 20/23 unknown
scaffold_2:93017209..93017231 20/23 unknown
scaffold_2:98948510..98948532 20/23 unknown
scaffold_24:618688..618710 20/23 unknown
scaffold_24:618769..618791 20/23 unknown
scaffold_34:144358..144380 20/23 unknown
scaffold_3:33445476..33445498 19/23 unknown
scaffold_1:111461384..111461406 19/23 unknown
scaffold_1:123003394..123003416 19/23 unknown
scaffold_1:125613550..125613572 19/23 unknown
scaffold_1:125613598..125613620 19/23 unknown
scaffold_1:125613758..125613780 19/23 unknown
scaffold_1:125613792..125613814 19/23 unknown
scaffold_1:125613889..125613911 19/23 unknown
scaffold_1:125613992..125614014 19/23 unknown
scaffold_1:125614042..125614064 19/23 unknown
scaffold_1:126697536..126697558 19/23 unknown
scaffold_1:131608606..131608628 19/23 Antisense off-target ebi3
scaffold_1:131820170..131820192 19/23 unknown
scaffold_1:131820220..131820242 19/23 unknown
scaffold_1:131820289..131820311 19/23 unknown
scaffold_1:131820388..131820410 19/23 unknown
scaffold_1:146295623..146295645 19/23 Antisense off-target mmrn1
scaffold_1:146295657..146295679 19/23 Antisense off-target mmrn1
scaffold_1:146295724..146295746 19/23 Antisense off-target mmrn1
scaffold_1:146295792..146295814 19/23 Antisense off-target mmrn1
scaffold_1:146295826..146295848 19/23 Antisense off-target mmrn1
scaffold_1:148030352..148030374 19/23 unknown
scaffold_1:148030403..148030425 19/23 unknown
scaffold_1:152915842..152915864 19/23 unknown
scaffold_1:152916025..152916047 19/23 unknown
scaffold_1:173127750..173127772 19/23 Antisense off-target tmem192
scaffold_1:17553105..17553127 19/23 unknown
scaffold_1:17553188..17553210 19/23 unknown
scaffold_1:17553389..17553411 19/23 unknown
scaffold_1:17553639..17553661 19/23 unknown
scaffold_1:17553722..17553744 19/23 unknown
scaffold_1:17553808..17553830 19/23 unknown
scaffold_1:17553873..17553895 19/23 unknown
scaffold_1:17553957..17553979 19/23 unknown
scaffold_1:17554056..17554078 19/23 unknown
scaffold_1:191429124..191429146 19/23 unknown
scaffold_1:191429223..191429245 19/23 unknown
scaffold_1:192384362..192384384 19/23 unknown
scaffold_1:200663717..200663739 19/23 unknown
scaffold_1:200663796..200663818 19/23 unknown
scaffold_1:200663860..200663882 19/23 unknown
scaffold_1:200663941..200663963 19/23 unknown
scaffold_1:200664037..200664059 19/23 unknown
scaffold_1:200664070..200664092 19/23 unknown
scaffold_1:200664166..200664188 19/23 unknown
scaffold_1:200664227..200664249 19/23 unknown
scaffold_1:200664339..200664361 19/23 unknown
scaffold_1:200664401..200664423 19/23 unknown
scaffold_1:200664433..200664455 19/23 unknown
scaffold_1:200667711..200667733 19/23 unknown
scaffold_1:200667806..200667828 19/23 unknown
scaffold_1:200667937..200667959 19/23 unknown
scaffold_1:212907123..212907145 19/23 unknown
scaffold_1:212907238..212907260 19/23 unknown
scaffold_1:212907304..212907326 19/23 unknown
scaffold_1:212907337..212907359 19/23 unknown
scaffold_1:215009445..215009467 19/23 unknown
scaffold_1:25951911..25951933 19/23 unknown
scaffold_1:25951990..25952012 19/23 unknown
scaffold_1:25952259..25952281 19/23 unknown
scaffold_1:26029232..26029254 19/23 unknown
scaffold_1:26029278..26029300 19/23 unknown
scaffold_1:26029357..26029379 19/23 unknown
scaffold_1:26029441..26029463 19/23 unknown
scaffold_1:26029519..26029541 19/23 unknown
scaffold_1:28486412..28486434 19/23 Sense off-target tmem161b
scaffold_1:31035320..31035342 19/23 unknown
scaffold_1:44113409..44113431 19/23 unknown
scaffold_1:44113443..44113465 19/23 unknown
scaffold_1:44113476..44113498 19/23 unknown
scaffold_1:44113543..44113565 19/23 unknown
scaffold_1:44113621..44113643 19/23 unknown
scaffold_1:44113655..44113677 19/23 unknown
scaffold_1:44113828..44113850 19/23 unknown
scaffold_1:44113879..44113901 19/23 unknown
scaffold_1:45524880..45524902 19/23 Sense off-target p2rx7
scaffold_1:45525377..45525399 19/23 Antisense off-target p2rx7
scaffold_1:45525456..45525478 19/23 Antisense off-target p2rx7
scaffold_1:46631848..46631870 19/23 Antisense off-target abcb9
scaffold_1:46631930..46631952 19/23 Antisense off-target abcb9
scaffold_1:47899840..47899862 19/23 Sense off-target ubc
scaffold_1:56657706..56657728 19/23 unknown
scaffold_1:56657758..56657780 19/23 unknown
scaffold_1:6476894..6476916 19/23 unknown
scaffold_1:6476953..6476975 19/23 unknown
scaffold_1:6477012..6477034 19/23 unknown
scaffold_1:6987233..6987255 19/23 Sense off-target haus1
scaffold_1:6987267..6987289 19/23 Sense off-target haus1
scaffold_1:6987371..6987393 19/23 Sense off-target haus1
scaffold_1:6987509..6987531 19/23 Sense off-target haus1
scaffold_1:6987560..6987582 19/23 Sense off-target haus1
scaffold_1:6987594..6987616 19/23 Sense off-target haus1
scaffold_1:72955903..72955925 19/23 unknown
scaffold_1:72955969..72955991 19/23 unknown
scaffold_1:74390060..74390082 19/23 unknown
scaffold_1:74390137..74390159 19/23 unknown
scaffold_1:74390216..74390238 19/23 unknown
scaffold_1:81781278..81781300 19/23 unknown
scaffold_1:82876261..82876283 19/23 unknown
scaffold_1:82876328..82876350 19/23 unknown
scaffold_1:83898298..83898320 19/23 unknown
scaffold_1:83913906..83913928 19/23 unknown
scaffold_1:84092412..84092434 19/23 unknown
scaffold_1:89403396..89403418 19/23 unknown
scaffold_1:89403430..89403452 19/23 unknown
scaffold_1:89403481..89403503 19/23 unknown
scaffold_1:95113220..95113242 19/23 unknown
scaffold_1:95371175..95371197 19/23 unknown
scaffold_1:98650998..98651020 19/23 unknown
scaffold_10:20222575..20222597 19/23 unknown
scaffold_10:20957761..20957783 19/23 unknown
scaffold_152:5315..5337 19/23 unknown
scaffold_152:5385..5407 19/23 unknown
scaffold_156:189805..189827 19/23 unknown
scaffold_156:202539..202561 19/23 unknown
scaffold_156:202683..202705 19/23 unknown
scaffold_156:202768..202790 19/23 unknown
scaffold_156:202852..202874 19/23 unknown
scaffold_1699:10227..10249 19/23 unknown
scaffold_17:305011..305033 19/23 unknown
scaffold_17:305061..305083 19/23 unknown
scaffold_17:305129..305151 19/23 unknown
scaffold_17:305197..305219 19/23 unknown
scaffold_17:305249..305271 19/23 unknown
scaffold_17:305317..305339 19/23 unknown
scaffold_17:305385..305407 19/23 unknown
scaffold_170:159744..159766 19/23 unknown
scaffold_170:159792..159814 19/23 unknown
scaffold_1714:39248..39270 19/23 unknown
scaffold_2:100294628..100294650 19/23 unknown
scaffold_2:102362871..102362893 19/23 unknown
scaffold_2:102363000..102363022 19/23 unknown
scaffold_2:102959269..102959291 19/23 unknown
scaffold_2:104654561..104654583 19/23 unknown
scaffold_2:104654641..104654663 19/23 unknown
scaffold_2:107598131..107598153 19/23 unknown
scaffold_2:107598206..107598228 19/23 unknown
scaffold_2:107598240..107598262 19/23 unknown
scaffold_2:107598307..107598329 19/23 unknown
scaffold_2:107598422..107598444 19/23 unknown
scaffold_2:108877901..108877923 19/23 unknown
scaffold_2:108878004..108878026 19/23 unknown
scaffold_2:108878038..108878060 19/23 unknown
scaffold_2:108878072..108878094 19/23 unknown
scaffold_2:108878106..108878128 19/23 unknown
scaffold_2:108878173..108878195 19/23 unknown
scaffold_2:108878240..108878262 19/23 unknown
scaffold_2:109711857..109711879 19/23 unknown
scaffold_2:109711960..109711982 19/23 unknown
scaffold_2:110056237..110056259 19/23 Sense off-target arhgap20
scaffold_2:110056304..110056326 19/23 Sense off-target arhgap20
scaffold_2:117650177..117650199 19/23 unknown
scaffold_2:117650208..117650230 19/23 unknown
scaffold_2:117650272..117650294 19/23 unknown
scaffold_2:117650463..117650485 19/23 unknown
scaffold_2:117650496..117650518 19/23 unknown
scaffold_2:12498345..12498367 19/23 unknown
scaffold_2:12498392..12498414 19/23 unknown
scaffold_2:130197280..130197302 19/23 Sense off-target grik1
scaffold_2:130197314..130197336 19/23 Sense off-target grik1
scaffold_2:130197348..130197370 19/23 Sense off-target grik1
scaffold_2:130197410..130197432 19/23 Sense off-target grik1
scaffold_2:134188874..134188896 19/23 Antisense off-target ccdc81
scaffold_2:134188942..134188964 19/23 Antisense off-target ccdc81
scaffold_2:134189044..134189066 19/23 Antisense off-target ccdc81
scaffold_2:134189078..134189100 19/23 Antisense off-target ccdc81
scaffold_2:134189113..134189135 19/23 Antisense off-target ccdc81
scaffold_2:134189181..134189203 19/23 Antisense off-target ccdc81
scaffold_2:13593094..13593116 19/23 Sense off-target zbtb8a.1
scaffold_2:13593144..13593166 19/23 Sense off-target zbtb8a.1
scaffold_2:136056777..136056799 19/23 Antisense off-target erg
scaffold_2:136056878..136056900 19/23 Antisense off-target erg
scaffold_2:140864107..140864129 19/23 unknown
scaffold_2:144226083..144226105 19/23 unknown
scaffold_2:144226117..144226139 19/23 unknown
scaffold_2:144226151..144226173 19/23 unknown
scaffold_2:144226185..144226207 19/23 unknown
scaffold_2:3464937..3464959 19/23 unknown
scaffold_2:3465035..3465057 19/23 unknown
scaffold_2:3465169..3465191 19/23 unknown
scaffold_2:47810641..47810663 19/23 unknown
scaffold_2:47810742..47810764 19/23 unknown
scaffold_2:47810774..47810796 19/23 unknown
scaffold_2:50098045..50098067 19/23 unknown
scaffold_2:51932909..51932931 19/23 unknown
scaffold_2:51932989..51933011 19/23 unknown
scaffold_2:53182240..53182262 19/23 Antisense off-target bzrap1
scaffold_2:53182286..53182308 19/23 Antisense off-target bzrap1
scaffold_2:53182320..53182342 19/23 Antisense off-target bzrap1
scaffold_2:55568918..55568940 19/23 unknown
scaffold_2:55568966..55568988 19/23 unknown
scaffold_2:55569095..55569117 19/23 unknown
scaffold_2:55569228..55569250 19/23 unknown
scaffold_2:57285467..57285489 19/23 unknown
scaffold_2:57285500..57285522 19/23 unknown
scaffold_2:57285533..57285555 19/23 unknown
scaffold_2:57285566..57285588 19/23 unknown
scaffold_2:57285599..57285621 19/23 unknown
scaffold_2:57285682..57285704 19/23 unknown
scaffold_2:57285811..57285833 19/23 unknown
scaffold_2:60524941..60524963 19/23 Sense off-target eif5b
scaffold_2:62629268..62629290 19/23 unknown
scaffold_2:64022090..64022112 19/23 unknown
scaffold_2:65365187..65365209 19/23 unknown
scaffold_2:76075895..76075917 19/23 unknown
scaffold_2:76936489..76936511 19/23 unknown
scaffold_2:76936537..76936559 19/23 unknown
scaffold_2:93159646..93159668 19/23 unknown
scaffold_2:93159919..93159941 19/23 unknown
scaffold_2:93159968..93159990 19/23 unknown
scaffold_2:95178017..95178039 19/23 unknown
scaffold_2:968954..968976 19/23 unknown
scaffold_2:98948543..98948565 19/23 unknown
scaffold_2:98948610..98948632 19/23 unknown
scaffold_2:98948644..98948666 19/23 unknown
scaffold_2:99512512..99512534 19/23 unknown
scaffold_204:45831..45853 19/23 unknown
scaffold_204:45940..45962 19/23 unknown
scaffold_204:46221..46243 19/23 unknown
scaffold_204:46286..46308 19/23 unknown
scaffold_24:618557..618579 19/23 unknown
scaffold_250:110965..110987 19/23 unknown
scaffold_250:111131..111153 19/23 unknown
scaffold_250:111228..111250 19/23 unknown
scaffold_250:111261..111283 19/23 unknown
scaffold_26:890637..890659 19/23 unknown
scaffold_3:110195216..110195238 19/23 Antisense off-target bend7
scaffold_3:110195250..110195272 19/23 Antisense off-target bend7
scaffold_3:110195284..110195306 19/23 Antisense off-target bend7
scaffold_3:20587263..20587285 19/23 Sense off-target c15orf33
scaffold_3:21016912..21016934 19/23 unknown
scaffold_3:21017059..21017081 19/23 unknown
scaffold_3:21017253..21017275 19/23 unknown
scaffold_3:23836672..23836694 19/23 unknown
scaffold_3:28165382..28165404 19/23 unknown
scaffold_3:28165450..28165472 19/23 unknown
scaffold_3:28165546..28165568 19/23 unknown
scaffold_3:28165643..28165665 19/23 unknown
scaffold_3:33445544..33445566 19/23 unknown
scaffold_3:33657414..33657436 19/23 unknown
scaffold_3:51496070..51496092 19/23 unknown
scaffold_3:51496140..51496162 19/23 unknown
scaffold_3:51496174..51496196 19/23 unknown
scaffold_3:51496208..51496230 19/23 unknown
scaffold_3:55630075..55630097 19/23 unknown
scaffold_3:55630153..55630175 19/23 unknown
scaffold_3:56718786..56718808 19/23 unknown
scaffold_3:67016912..67016934 19/23 unknown
scaffold_3:67016996..67017018 19/23 unknown
scaffold_3:67673878..67673900 19/23 unknown
scaffold_3:68170920..68170942 19/23 unknown
scaffold_3:68171005..68171027 19/23 unknown
scaffold_3:68171107..68171129 19/23 unknown
scaffold_3:68171222..68171244 19/23 unknown
scaffold_3:68171288..68171310 19/23 unknown
scaffold_3:83623918..83623940 19/23 unknown
scaffold_3:83623952..83623974 19/23 unknown
scaffold_3:83624087..83624109 19/23 unknown
scaffold_3:83624202..83624224 19/23 unknown
scaffold_3:83624266..83624288 19/23 unknown
scaffold_3:96000094..96000116 19/23 Antisense off-target mdfic
scaffold_3:96599456..96599478 19/23 unknown
scaffold_3:96599489..96599511 19/23 unknown
scaffold_3:96599569..96599591 19/23 unknown
scaffold_30:687872..687894 19/23 unknown
scaffold_30:687957..687979 19/23 unknown
scaffold_30:688074..688096 19/23 unknown
scaffold_34:850874..850896 19/23 unknown
scaffold_4:10126291..10126313 19/23 unknown
scaffold_4:110967271..110967293 19/23 Antisense off-target qsox1
scaffold_4:110967305..110967327 19/23 Antisense off-target qsox1
scaffold_4:112717845..112717867 19/23 unknown
scaffold_4:112717878..112717900 19/23 unknown
scaffold_4:113730241..113730263 19/23 unknown
scaffold_4:113730273..113730295 19/23 unknown
scaffold_4:128047873..128047895 19/23 unknown
Publications
First: Developmental regulation of Wnt signaling by Nagk and the UDP-GlcNAc salvage pathway., Mech Dev 2019                                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556