Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22064432

Morpholino Name: kmt2d MO1
Synonyms:
mRNA Target: kmt2d

Morpholino Type: translation blocking morpholino
Sequence:
5' GCCTTTTGTTCATCCATTCCTGTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14978:3423544..3423568 25/25 unknown
Scaffold8129:6531356..6531380 23/25 Antisense off-target Xelaev16074720m
Scaffold176467:1328181..1328205 22/25 unknown
Scaffold66475:1857265..1857289 22/25 Sense off-target Xelaev16067778m
Scaffold268711:1238424..1238448 21/25 Sense off-target anxa1
tropicalis 7.1 scaffold_2:78024367..78024391 23/25 Antisense off-target mll2
scaffold_3:76766726..76766750 22/25 Sense off-target cdc25c
scaffold_5:121680651..121680675 21/25 unknown
scaffold_5b:4651826..4651850 21/25 unknown
Publications
First: Loss of function of Kmt2d, a gene mutated in Kabuki syndrome, affects heart development in Xenopus laevis., Dev Dyn 2019                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556